rmc@codon2 public_html]$ /usr/bin/perl new.pl~
What is the name of your DNA sequence file?
test.seq
What should I call the output file?
test.aa
[rmc@codon2 public_html]$ ls -l
----------------
drwxr-xr-x
2 rmc rmc
4096 Mar 13 15:09 cgi-bin
-rwxr-xr-x
1 rmc rmc
9 Mar 13 15:06 cliff.pep
-rwxr-xr-x
1 rmc rmc
3536 Mar 13 15:06 dataextraction.pl
-rwxr-xr-x
1 rmc rmc
3536 Mar 13 15:06 dataextraction.pl~
-rwxr-xr-x
1 rmc rmc
170 Mar 14 10:55 index.html
-rwxr-xr-x
1 rmc rmc
172 Mar 13 15:07 index.html~
-rwxr-xr-x
1 rmc rmc
1433 Mar 13 15:06 new.pl~
********
-rw-rw-r--
1 rmc rmc
9 Mar 14 12:11 test.aa?.pep
-rwxr-xr-x 1 rmc
rmc
25 Mar 13 15:06 test.seq
*********
-rwxr-xr-x
1 rmc rmc
1426 Mar 13 15:06 translate.pl
[rmc@codon2 public_html]$ cat test.aa*
MTTPWHI*
-rwxrwxr-x
1 rmc rmc
2976 Mar 13 15:09 form
-rw-rw-r--
1 rmc rmc
112 Mar 13 15:09 test2.pl
-rw-rw-r--
1 rmc rmc
119 Mar 13 15:09 test2.pl~
-rw-rw-r--
1 rmc rmc
39 Mar 13 15:09 testing.pl
-rwxrwxr-x
1 rmc rmc
5289 Mar 14 11:03 translate.pl
-rwxrwxr-x
1 rmc rmc
5077 Mar 13 15:09 translate.pl~
[rmc@codon2 cgi-bin]$ chmod 755 ./*
[rmc@codon2 cgi-bin]$ ls –l
[rmc@codon2 public_html]$ ls -l
total 24
drwxr-xr-x
2 rmc rmc
4096 Mar 14 13:45 cgi-bin
-rwxr-xr-x 1 rmc
rmc
170 Mar 14 10:55 index.html
-rwxr-xr-x
1 rmc rmc
172 Mar 13 15:07 index.html~
-rwxr-xr-x
1 rmc rmc
1433 Mar 13 15:06 new.pl~
-rw-rw-r--
1 rmc rmc
9 Mar 14 13:37 out1?.pep
-rwxr-xr-x
1 rmc rmc
25 Mar 13 15:06 test.seq
[rmc@codon2 public_html]$ cat new.pl~ > microtrans.pl
[rmc@codon2 public_html]$ ls -l
drwxr-xr-x
2 rmc rmc
4096 Mar 14 13:45 cgi-bin
-rwxr-xr-x
1 rmc rmc
170 Mar 14 10:55 index.html
-rwxr-xr-x
1 rmc rmc
172 Mar 13 15:07 index.html~
-rw-rw-r--
1 rmc rmc
1433 Mar 14 13:49 microtrans.pl
-rwxr-xr-x
1 rmc rmc
1433 Mar 13 15:06 new.pl~
-rw-rw-r--
1 rmc rmc
9 Mar 14 13:37 out1?.pep
-rwxr-xr-x
1 rmc rmc
25 Mar 13 15:06 test.seq
[rmc@codon2 public_html]$ cat new.pl~ (earlier copied it to microtrans.pl
perl script below for new.pl~ and/or microtrans.pl
#!/usr/bin/perl
print "What is the name of your DNA sequence file?\n ";
$file=<STDIN>;
open(SEQFILE,"$file");
$sequence=<SEQFILE>;
chop $sequence;
close(SEQFILE);
print "\n\nWhat should I call the output file?\n ";
$outfile=<STDIN>;
open(PEPFILE,">>$outfile".".pep");
%code=
("TTT"=>"F","TTC"=>"F","TTA"=>"L","TTG"=>"L","CTT"=>"L","CTC"=>"L","CTA"=>"L","CTG"=>"L",
"ATT"=>"I","ATC"=>"I","ATA"=>"I","ATG"=>"M","GTT"=>"V","GTC"=>"V","GTA"=>"V","GTG"=>"V",
"TCT"=>"S","TCC"=>"S","TCA"=>"S","TCG"=>"S","CCT"=>"P","CCC"=>"P","CCA"=>"P","CCG"=>"P",
"ACT"=>"T","ACC"=>"T","ACA"=>"T","ACG"=>"T","GCT"=>"A","GCC"=>"A","GCA"=>"A","GCG"=>"A",
"TAT"=>"Y","TAC"=>"Y","TAA"=>"*","TAG"=>"*","CAT"=>"H","CAC"=>"H","CAA"=>"Q","CAG"=>"Q",
"AAT"=>"N","AAC"=>"N","AAA"=>"K","AAG"=>"K","GAT"=>"D","GAC"=>"D","GAA"=>"E","GAG"=>"E",
"TGT"=>"C","TGC"=>"C","TGA"=>"*","TGG"=>"W","CGT"=>"R","CGC"=>"R","CGA"=>"R","CGG"=>"R",
"AGT"=>"S","AGC"=>"S","AGA"=>"R","AGG"=>"R","GGT"=>"G","GGC"=>"G","GGA"=>"G","GGG"=>"G");
for ($count=0; $count<length($sequence); $count++) {
$pointer=$count*3;
$codon=substr($sequence,$pointer,3);
$this{$codon}++; ## tablulate codon usage
$residue=$code{$codon};
$peptide.=$residue; ## append residue onto translation
$composition{$residue}++; ## tabulate amino acid composition
}
print PEPFILE "$peptide\n";
[rmc@codon2 public_html]$ cat test.seq
ATGACTACACCGTGGCATATCTGA
[rmc@codon2 public_html]$ cat out*
MTTPWHI*